Friday, March 19, 2010

Genetic Variety Blog

































Each bug has a different set of chromosomes. They each pass down different traits to their children randomly. So each child gets a different set too.
Meiosis is the main cause of this because in the process only half of the DNA is randomly put in each new haploid cell. Also, some genes are crossed over when the chromosomes are in tetrads. So if when this happens in you some of your dad's genes are now on your mom's chromosome. This makes it so you can have different combinations of genes.

Say hair color and eye color are on the same chromosome, and brown eye color and brown hair color are dominant traits and all other colors in both catagories are recessive. If your dad has brown hair and brown eyes on one chromosome, and green eyes and blonde hair on another, and he passes on the first chromosome, then your only possibility is brown hair and eyes. But if traits are crossed over, so green eyes and brown eyes switch, then (provided what mom passes on) you have a chance to have green eyes. Otherwise brown eyes and hair would always come together.
Also because there is always a 5o% chance that a chromosome will be passed on, new traits are always appearing in children.
As you can see in these pictures, old colors are kept in the family. First there is only brown, then blue and brown. Next purple, pink, blue, and brown. And finaly, pink, yellow, blue, orange, white, purple, and brown. And not all of my bugs look the same. Two are brown, one is green, and one is yellow, all but one has wings, and three are boys, and one is a girl. Yet some traits stayed the same for all of them like all of them have dots, and all of them have red eyes. Just like in humans, Reebops share some traits with one parent and others with the other parent. Some traits can be shared with none. With my yellow bug, neither parent was yellow, they just both had the trait.

Monday, March 8, 2010




Incomplete and Co dominance are somewhat confusing. The thing to remember is in Co dominence the traits don't mix. In incomplete dominence the traits do mix. Take a flower for instance. Say you have a red and a white flower that pollenate together. If flower color is Co dominant then you would get a flower with red and white pedals. If it is incomplete dominence then you would get a flower with pink pedals.


An experiment we could of done is exactly what I just talked about. Pollenate red and white flowers and see what color/s the pedals of the offspring are. We could do this with many types of flowers (roses, tulips, etc) and many different colors.

Saturday, January 30, 2010

le Blog de Jeremy


Learning about the crossing over of DNA in Prophase 1 of Meiosis was hard. Thining back on it, I wish I learned earlier that the crossing over happens between haploid pairs. Haploid pairs are the pairs of chromosomes, one form your father and one from your mother. There are 23 haploid pairs in a human body. The haploid pairs form what is known as a tetrad. I had believed that crossing over could happen between any two chromosomes. This would not work because then some people would be missing important genetic info like how to make protiens. The discussion about Sandra, Mike, and Chris Serbert helped me learn the idea. It showed how no matter what, every sperm, egg, or pollen cell made in Meosis is different.

Saturday, January 23, 2010

Jeremy's Blog

I was only in class 3 days this week. One of the two days was spent taking a quiz so we only had two good working days. We finished up with cell reproduction and started on multi cellular reproducrion. We learned that there are 46 chromosomes in a human body. When we reproduce, we give 23 of the 46. By getting half the chromosomes from each parent it makes every person look and act different. If every person got the full DNA from their parents, every person would have double the DNA and would explode from having too much info in their bodies. There are two sex chromosomes out of the 46. X and Y or X and X. If a person has two x's they will be a girl. If a person is a boy they will have an x and y. The other 44 chromosomes are autosomes which control all other things. Anything that differs between boys and girls if found in x and y. The others determine things that doesn't matter between boys and girls like hair and eye color.

Now we started getting into meosis. We started to look at a simulation of meosis. The first things we noticed was that it is almost idntical to mitosis. The biggest difference is meosis makes four cells by dividing twice. The DNA is not replicated inbetween the two divisions so you end up with 4 cells with 23 chromosomes. Before the proccess starts tetrads, or groups of four chromosomes form. In the tetrad some of the genes go the the other side of the tetrad.

In my own reaserch I learned that in meosis sperm and egg cells are formed. The proccess only happens in animals because of this. All of the phases of mitosis are present in meosis. The same things happen in each phase in meosis as in mitosis except Prophase. The difference is each phase happens twice.

Saturday, January 16, 2010

It was a bad week in science this week. We had a sub twice in the week and I was absent one of the days the sub was there. We continued with mitosis this week. We talked about how chromosomes change during mitosis and a cell's life. They start as chromatin, and unwoung mess of DNA in the nucleus. Then it condences into a chromosome. Then the chromosome is copied and conected to the copy at a kinetacore. The two chromosomes individualy are now called chromatids, while together they are a chromosome. Then when the two chromatids separate during anaphase of Mitosis, they are each chromosomes again. And in telophase when two nuclei are formed they unwind into chromatin again.

We then learned about the cell cycle. It has four stages. Gap 1, Syntesis, Gap 2, and Mitosis. In Gap 1 the cell does regular things like making protiens and growing. At the end of Gap 1, the cell checks if all the conditions are right to reproduce. If not, it repeats Gap 1, if the conditions are right it moves to synthesis. In synthesis the cell copies all the DNA in it's nucleus. Then it moves to Gap 2 where it grows more in preporation to Mitosis, and it makes any protiens it will need in Mitosis. Now the cell moves to Mitosis where it splits apart to form two daughter cells. Then the cell cycle starts over with Gap 1 in both cells. The lenth of the full cycle varies for different types of cells. A skin cell might take 8 hours to go through the cycle, but a heart cell could take 45 years.

We learned about how much time a cell spends in each phase, Interphase, Prophase, Metaphase, Anaphase, and Telophase. 56% of it's time is in Interphase, 28% in Prophase, 8% in Metaphase, 6% in Anaphase, and 3% in Telophase. So if it takes a cell 24 hours to go through all these, 13.44 hours are spent in Interphase, 6.72 hours in Prophase, 1.92 hours in Metaphase, 1.44 hours in Anaphase, and 0.72 hours in Telophase.

Saturday, January 9, 2010

Science First week after Christmas 1/9

This week was kind of awkward because we were discossing reproduction and its difference from sex. The first thing we wanted to do was clarrify the difference between the two things. We only want to learn about reproduction. Reproduction is the sperm meeting with the egg cell. We knew how mammals and some other animals reproduced, but we did not know how cell reproduce. A living thing grows because cells are reproducing. Cells reproducing is the basic part of human reproduction.

We had two theories on how cells reproduce.One theory we had was that cells reproduced with a sperm cell and egg cell. But this didn't make sence because a single cell would not produce a sperm cell and an egg cell just to make one cell. Also, we knew cells reprodused as one not as two, unlike humans. Our other theory was that cells split themselves in half from one mother cells into two daughter cells.

Wecame up with certain things that must happen in cell reproduction.DNA must be copied because otherwise the cells would not look the same and they would each only have half the DNA the original cell had. Another problem was having each cell have all of the organelles such as mitochondria and ribosomes. We thought that that the cell may create double the amount of each organelle it has. The last problem we saw was if a cell splits in half, it makes two cells half the size the origonal. This would cause the organism not to grow. We decided that the cells must grow at some point in their life.

We learned that the Cell does copy its DNA and reproduce in a prosses called mitosis. The steps of mitosis are Prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis. In prophase DNA is copied and the nucleus begins to fade. In Prometaphase the nucleus is gone and there is only chromosomes. Metaphase is when the chromosomes align in the center of the cell. Anaphase is when spindle fibers connect to the kinetochores and start to pull the chromosomes apart from their copies to the poles of the cell. In telophase the chromosomes form two nuclei at the poles of the cell. In the last step cyokinesis, the cell separates into two separate cells.

Saturday, December 19, 2009

Science Before Christmas

This week was all about cells. We read about the discovery of DNA and about resperation vs photosynthosis. We watched a great video about a Ribosome and RNA. It showed how all the organelles work together. All of the organelles seem to need the ribosome or help the ribosome. It also showed how much is cramed in a tiny little cell.

Another video we watched was Yakko's Universe Song. The song tells how everything is made of something smaller. We did this on humans. Atoms makes molucules, and molucules make organelles, organelles make cells, to tissue, tissues make organs, and organs make systems, and all of the systems make a human being. The video helped me understand how small things get. Where if you can't see a cell with a naked eye, then how small is the stuff smaller than a cell.

We have been given the project of thinking of something in life like a city of country that is like a cell. I choose a town because everything inside works together to do things. Also, there are a lot of things that can be compared to cell organelles. A city hall is like the nucleus. Taxes are like the mRNA. Money is like the protiens. A tax office is like a rough E.R and ribosomes are houses and stores. A train station could be like the golgi apperatus. A power plant is like the mitocondria doing resperation. All of these things work together like the organelles of a cell.

Saturday, December 12, 2009

December 12th

We talked about the parts of DNA. It has two sugar backbones conected by four kinds of bases. Adenine, thynine, cytozine, and guadenine (Abriviated: A, T, C, G). A and T are a base pair and connect together. G and C are a base pair, so they connect together. If you had a sugar backbone with AACGCTGGCTTTAGCCTAAA, the other sugar backbone would be, TTGCGACCGAAATCGGATTT.

All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.

The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.

The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.

Saturday, December 5, 2009

Science December 1st-5th

This week we continued with photosynthosis in class. We noticed that resperation and photosynthosis work as a cycle in some ways. The starting material for each is the ending for the other. They help each other to complete their job. They are also not a cycle because new CO2 and H2O are always coming in and O2 is always leaving. We also learned that photosynthosis is like the opposite of resperation.

Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.

We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.

We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.

Sunday, November 22, 2009

This week we talked about resperation and photosythosis. We wanted to know what resperation does and what ingredients it uses. We broke it down into an intake and exhale. Someone said that O2 (oxygen) goes is, and CO2 (carbondioxide) comes out. Also, we knew for a fact from a past experiment that H2O is exhaled in resperation. We did experiments and reaserch to learn if this was true and if there was anything else to reperation.

Our first test was to see if it was true that CO2 is expeled in resperation. Mr. Segan had a CO2 sensor that we could use. The experiment was, we put the CO2 sensor in a jar and got a control reading. Then we took out the sensor and Mr. Segan exhaled into the jar and put the sensor back in. If CO2 is and ending ingredient, then the amount of CO2 in the jar should go up when you exhale into the jar. Our hypothesis turned out to be correct, so we knew that CO2 was an ending ingredient.

Now we needed to do an exeriment to learn if O2 only goes in and doesn't come out. We were split into groups to create experiments. My group knew that when you blow into something, air comes out, and that when you pull air out of something, new air rushes in. We decided to read the amount of O2 in the jar, then exhale into the jar like for the CO2 test, only we were expecting the O2 level to go down, and it did. This proved that oxygen comes in but not out in resperation.

What we didn't understand was, what was happening to the oxygen, and where does the CO2 and H2O come from. We started to mention atoms in class. We said that O2 means 2 oxymen atoms together. CO2 means 1 carbon atom, and 2 oxygen atoms. H2O means 2 hydrogen atoms and 1 oxygen atom. So really it wasn't O2 going in and H2O/ CO2 coming out, it was two oxygen atoms going in and 2 oxygen atoms coming out with one carbon atom and 2 hydrogen atoms.

But we still had the same problem, where did the carbon atom and two hydrogen atoms come from. We eventually said from food and water we eat and drink. We looked it up and carbohydrates are made of hydrogen, carbon and oxygen. The formula for carbohydrates is C6 H12 O6. Now the intake was O8 C6 H12 but the exhale was still CO2 and H2O. We needed to find the balanced amount that could go in and come out as complete CO2s and H2Os. We came up with C6 H12 O18 as the formula that creates complete resperation.

Now we are starting to understand photosythesis in class. I think that photosynthesis does everything reverse.

Thursday, November 5, 2009

This week, the whole three days were devoted to the parts of animal, plant, and bacteria cells. We discussed simalarities and differences between the three. We used triple ven diagrams to compare the three cells. The animal and plant cells had almost all of the same organells. Their shapes though were completly different. A plant cell is like a brick and all the cells fit together. Animal cells have a sphere shape.



The three main organell differences between animal and plant cells are the chlorolplasts, cell wall, and vacuole. Chlorolplasts are only in plant cells. They create chlorophil to make the plant green. Only the plant cells has the cell wall and they use it to create their brick shape. The vacuole is in both cells, but it is bigger in the plant cell. The larger vacuole fills with water and makes the cell rigid. That is why when plants don't get water they wilt. This happens because the vacuole is drying up.



The last thing we did was talk about paramecium. We learned they are animal cells and is covered in cilla to move. We decided it lives in stagnant water like a lake or pond. We looked under a microscope at lake water to see what we could find. The paramecium we found were extremly fast and tiny. All that we couls make out was a clear oval with a black outline.

Saturday, October 31, 2009

Science October 31st

This week we concluded that salminila caused the outbreak at Jefferson and Truman. Salminila fit in every way. It had the same symptoms. It is Gram negitive like our grams test said. Lastly it is a bacteria common in chicken which we had deduced was where the outbreak was coming from. Our lab reports were supposed to explain the prosseses we went through to reach our final decicion.

Now we wanted to know, what is a cell? What are they made of, what do they do, what do they look like? We conducted a test to look at our cheek cells. One slide was made with water and cells, another was made with cells and methaline blue. The methaline blue made the cells more visable under microscope. We saw all of the cells have a dot in the center called a nucleus. We could also just make out other things in the cell. The cells, even for tiny things are very complex. This was proven through homework where we had to draw a labled diagram of animal and plant cells. They are different, but relativly the same. Some things like the vacuole are only in the plant cell and visa versa.

What do plant cells look like under a microscope? We cut a potato into see through slices, then we could see the cells within under a microscope. We used two dies this time. Lugal solution and Methaline blue. Each showed different parts of the cells better. I believe the metaline blue shows the nucleus and lugal shows the other organelles. We also looked at grass which was amazing to look at. Each cell was like a brick and they all fit together in perfect rows. It was like a wall. I couldn't see the different parts of the cell like in the potatos. I think that is because the grass has color and is not clear like the potato cells.

On Friday we played a game to test our knowlage of plant and animal cells. We took a long time with the plant cell and went very quickly on the animal cell. Many of the parts with simaler names and places got very mixed up. The whole week turned out to be a test devised by Mr. Finley to learn if something he learned at a teachers meeting was true, and it was.

Saturday, October 24, 2009

10/19 Science

I was only in school for one day this week. In that day we discussed the things in the pond. I shared that the small crustations everyone saw were water fleas. There was also alge in the water that we could see. Nothing we could see was visable. Almost all bacterias and viruses are not visible under a microscope. We said there could still be bacteria in the water.

Next we came up with four possible bacteria for the chicken. Salmonella, staphylococcus aureus, campylobacter, and listeria monocytogenes are all found with chicken.

-Staphylococcus causes pimmples, boils, and impatego. It also causes more life threatening viruses like meningitis and pneumonia. None of these diseases relate to the symptoms the infected people described.

-Salmonella is found in eggs. It is one of the most common foodborn diseases. People expirience fever, diarrhea, abdomanal cramps, chills, nausea, and vomiting. Salmonella has all of the symptoms the middle schoolers had. This is the website I found to learn about salmonella. http://www.fsis.usda.gov/factsheets/salmonella_questions_&_answers/index.asp

-Campylobacter is one of the main cause of bacterial foodborn diseases. It causes tissue damage in the colon. None of the people absent had colon damage.

-Listeria Monocytogenes causes muscle aches, fever, and sometimes nausea and diarrhea. It can cause Menintgitis. It doesn't match at all. The disease only appears in newborns, old people, and pregnant women.

Salmonella is the one the fits the discription most. The chicken could have had a lot on it and the kids ate it.

Sunday, October 18, 2009

Science October 18

This week we finally tested for organisms in the pond water, in the chicken, on the knife, on the pan, and in or on the bread samples.We had to have one microsope test and test at least two things in a petri dish. Before we were allowed to use the microscopes we had to take three quizes.

Monday: I was not there on Monday because of a doctors appointment. When I got to class in the last five minutes the rest of my group was doing a reviw sheet. We did not get much done.

Tuesday: On tuesday we made our petri dish and took the written parts quiz. We first divided the petri dish into fourths and labled them. One was chicken surface and another was top of bread. The other two were knife handle and pond water. The parts quiz was difficult, it took a while but I remembered all but one part, the Body Tube. The day helped me learn to write my procedures as specific as posible.

Wednesday: We observed our petri dish from yesterday. My prediction was that the chicken and knife would have the same amount and that the pond water would have the most bacteria also. I was wrong on both acounts. The chicken ended up having it's whole quarter filled with yellow bactiria. The water had a lot, just not as much. The knife had only 10 small colonies and the bread had none. After everything was recorded, we took the oaral parts and functions quiz.

Thursday: We observed our petri dish one more time. The chicken looked the same, maybe a little bigger. The pond water had more colonies than the day before and they were bigger. The colonies on the knife had gotten bigger. Three that had been close the day before has fused because they grew. The top to the bread still had no bacteria. Then we took the slide making quiz. After that we were free to use the microscopes. We wrote down our procedures, got them approved and spent ten minutes on a microscope looking at pond water. We did not make any pictures on thursday which was a mistake.

Friday: We spent the whole class looking at the pond water through a microscope. We found a very fast organism that looked like a shrimp. It had two eyes, a tail to move with, feelers coming from a mouth of some sort, and multiple legs from its abdomen. It did not look like its eyes were very good because it kept hitting plant life. I looked it up and it is a form of crustation. It is a water flea. The type of water flea I, was unable to determine.

Now my group just needs to get the blood results and make our lab reports.

Thursday, October 8, 2009

Science 10/8

We got the results of our petri dishes on Monday. They were discusting. Yellow bactiria colonies growing on the glass. The weird thing was that we were supposed to choose something that would have lots of bactiria in the bathroom and something that has none. Our results got flip flopped. Our control clean sample was an empire while the supposed to be dirty one was almost empty. Our mistake was thet we choose the drain as the control. All of the bactiria in the sink goes to the drain. I learned many things about bactira through the experimet such as it spreads everywhere and fast.



Later in the week we were discussing viruses. We wanted to know if they were living. I learned about one type of virus that has a capsid, nuclic acid, tails, a sheath, and a rod. When We confirmed that they are not living because it is not composed of cells. I said it could posibly be single celled, but I was wrong. There is no cell wall, capsule, or DNA in a virus to name a few. They have RNA which stands for Ribonuclic Acid. That made me think it sounds like ribosomes. So maybe viruses are living.





We started talking about what fats and oils are used for. I had thought they were stored energy. Turns out it is used by viruses to not fusing with water based liquids. Here is a video of an experiment I did.


We are finally going to start doing experiments to learn what the epademic at Truman Middle School is. I think a good way to test everything would be to have a petri dish with water sample, equiptment sample, and food sample. Then the next day while the bactiria grows take the microscope test. The next day having passed the test I could make a slide for each of the three samples and examint them through the microscope. On thursday I could examine the petri dish I made on Monday. On Friday I could get the results of the blood and work on my Lab Report.

Saturday, October 3, 2009

Science 10/3

In science we continued our work with disseases. We had Monday off so we did not have much time for work this week. We looked at new data on the Truman and Jackson Middle School outbreak. We looked at the symptoms each student had. All of them had to do with food, such as vomiting, stomach aches, and diarrhea. Many students claimed food poisining and that it is worse the next day. That tells me the outbreak sets in slowly. Also, almost all of the students who were sick went to the same restrant and went swimming.

To test all of our data we are having water samples, blood samples, and food samples sent to us. We could use petri dishes to see what bactiria is on each sample. We practiced this by checking a bathroom for bactiria. Take a cotton swab ( steralized) and RUB it GENTLY on a surface. Then quickly Rub that same side inside the petri dish, on one side, in a z pattern. If you then leave it in a warm place upside down for a few days, bactiria will grow. We have not gotten the results of our bathroom test yet though.

On wednesday I don't think me or the rest of the class understood how small viruses are. Mr. Finley gave us this site tat slowly shows how small things are. First there was a needle with a hair on it. Then it zoomed and you d see dust mites on the head of the needle. Then it zoomed more on the needle head to show red blood cells, pollen and yeast. Then more to show E. coli, zoom, and it showed still on the needle a rhinovirus. This opened many questions and taught me many things. I had never known that virused were smaller than rad blood cells, I had thought the were the same size.

In class we discussed what things in the video were Macroscopic, Microscopic, and Sub-Microscopic. We had to firth decide what each word means. Macroscopic is too big for a microscope. We decides the hair was Macroscopic. Sub-Microscopic things are too small for a regulas microscope. Bactiria and viruses are in this catagory. So we had to think of a new way to see the outbreak. That is why we are using the test from paragrah 2. Everything we did this week helps us identafy the outbreak at Truman and Jackson.

Saturday, September 26, 2009

Science 9/26

We had another exciting week in science. We continued our work with the charictaristics of life. We classified things into living and nonliving. Then we relized that those two catagories were not enough. We added two more catagories, dead and dormant. Then we noticed that we had trouble catagorizing things still such as an apple. For homework, we were assigned to think and write about why it is difficult to catagorize as a class. I wrote that because people are sometimes not as open minded or acceptive of ideas. It all depends on how creative you are.

We were told later in the week that we are going to do research to help Truman Middle School. The students there seem to be getting a disease, and are absent all the time. We looked at their website for info on the outbreak. Their attendance sheets gave us a good amount of info. Mr. Finley told us to make hypothesis about the disease. One that I noticed was that on May 22 something changed such as climate to cause more students to recive the illness. Tothether as a class we discused or hypthesises, that caused us to reach a dillema.

What is the difference between a prediction and a hypothesis? That was the problem. Mr. Finley helped us understand the difference. Hypothesises are testable questions based on fact. A prediction can only be made after a hypothesis is tested. A prediction is based off of the test results and can never be wrong. Only a hypothesis can be wrong.

The best part of the week was when Mr. Finley proved me wrong . I said metal can't burn. To prove me wrong he lit a piece of magnisium on fire. Coolest thing EVER.