This week was all about cells. We read about the discovery of DNA and about resperation vs photosynthosis. We watched a great video about a Ribosome and RNA. It showed how all the organelles work together. All of the organelles seem to need the ribosome or help the ribosome. It also showed how much is cramed in a tiny little cell.
Another video we watched was Yakko's Universe Song. The song tells how everything is made of something smaller. We did this on humans. Atoms makes molucules, and molucules make organelles, organelles make cells, to tissue, tissues make organs, and organs make systems, and all of the systems make a human being. The video helped me understand how small things get. Where if you can't see a cell with a naked eye, then how small is the stuff smaller than a cell.
We have been given the project of thinking of something in life like a city of country that is like a cell. I choose a town because everything inside works together to do things. Also, there are a lot of things that can be compared to cell organelles. A city hall is like the nucleus. Taxes are like the mRNA. Money is like the protiens. A tax office is like a rough E.R and ribosomes are houses and stores. A train station could be like the golgi apperatus. A power plant is like the mitocondria doing resperation. All of these things work together like the organelles of a cell.
Saturday, December 19, 2009
Saturday, December 12, 2009
December 12th
We talked about the parts of DNA. It has two sugar backbones conected by four kinds of bases. Adenine, thynine, cytozine, and guadenine (Abriviated: A, T, C, G). A and T are a base pair and connect together. G and C are a base pair, so they connect together. If you had a sugar backbone with AACGCTGGCTTTAGCCTAAA, the other sugar backbone would be, TTGCGACCGAAATCGGATTT.
All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.
The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.
The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.
All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.
The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.
The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.
Saturday, December 5, 2009
Science December 1st-5th
This week we continued with photosynthosis in class. We noticed that resperation and photosynthosis work as a cycle in some ways. The starting material for each is the ending for the other. They help each other to complete their job. They are also not a cycle because new CO2 and H2O are always coming in and O2 is always leaving. We also learned that photosynthosis is like the opposite of resperation.
Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.
We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.
We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.
Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.
We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.
We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.
Subscribe to:
Posts (Atom)
