December 12th

We talked about the parts of DNA. It has two sugar backbones conected by four kinds of bases. Adenine, thynine, cytozine, and guadenine (Abriviated: A, T, C, G). A and T are a base pair and connect together. G and C are a base pair, so they connect together. If you had a sugar backbone with AACGCTGGCTTTAGCCTAAA, the other sugar backbone would be, TTGCGACCGAAATCGGATTT.

All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.

The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.

The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.