We talked about the parts of DNA. It has two sugar backbones conected by four kinds of bases. Adenine, thynine, cytozine, and guadenine (Abriviated: A, T, C, G). A and T are a base pair and connect together. G and C are a base pair, so they connect together. If you had a sugar backbone with AACGCTGGCTTTAGCCTAAA, the other sugar backbone would be, TTGCGACCGAAATCGGATTT.
All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.
The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.
The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.
Saturday, December 12, 2009
Saturday, December 5, 2009
Science December 1st-5th
This week we continued with photosynthosis in class. We noticed that resperation and photosynthosis work as a cycle in some ways. The starting material for each is the ending for the other. They help each other to complete their job. They are also not a cycle because new CO2 and H2O are always coming in and O2 is always leaving. We also learned that photosynthosis is like the opposite of resperation.
Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.
We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.
We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.
Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.
We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.
We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.
Sunday, November 22, 2009
This week we talked about resperation and photosythosis. We wanted to know what resperation does and what ingredients it uses. We broke it down into an intake and exhale. Someone said that O2 (oxygen) goes is, and CO2 (carbondioxide) comes out. Also, we knew for a fact from a past experiment that H2O is exhaled in resperation. We did experiments and reaserch to learn if this was true and if there was anything else to reperation.
Our first test was to see if it was true that CO2 is expeled in resperation. Mr. Segan had a CO2 sensor that we could use. The experiment was, we put the CO2 sensor in a jar and got a control reading. Then we took out the sensor and Mr. Segan exhaled into the jar and put the sensor back in. If CO2 is and ending ingredient, then the amount of CO2 in the jar should go up when you exhale into the jar. Our hypothesis turned out to be correct, so we knew that CO2 was an ending ingredient.
Now we needed to do an exeriment to learn if O2 only goes in and doesn't come out. We were split into groups to create experiments. My group knew that when you blow into something, air comes out, and that when you pull air out of something, new air rushes in. We decided to read the amount of O2 in the jar, then exhale into the jar like for the CO2 test, only we were expecting the O2 level to go down, and it did. This proved that oxygen comes in but not out in resperation.
What we didn't understand was, what was happening to the oxygen, and where does the CO2 and H2O come from. We started to mention atoms in class. We said that O2 means 2 oxymen atoms together. CO2 means 1 carbon atom, and 2 oxygen atoms. H2O means 2 hydrogen atoms and 1 oxygen atom. So really it wasn't O2 going in and H2O/ CO2 coming out, it was two oxygen atoms going in and 2 oxygen atoms coming out with one carbon atom and 2 hydrogen atoms.
But we still had the same problem, where did the carbon atom and two hydrogen atoms come from. We eventually said from food and water we eat and drink. We looked it up and carbohydrates are made of hydrogen, carbon and oxygen. The formula for carbohydrates is C6 H12 O6. Now the intake was O8 C6 H12 but the exhale was still CO2 and H2O. We needed to find the balanced amount that could go in and come out as complete CO2s and H2Os. We came up with C6 H12 O18 as the formula that creates complete resperation.
Now we are starting to understand photosythesis in class. I think that photosynthesis does everything reverse.
Our first test was to see if it was true that CO2 is expeled in resperation. Mr. Segan had a CO2 sensor that we could use. The experiment was, we put the CO2 sensor in a jar and got a control reading. Then we took out the sensor and Mr. Segan exhaled into the jar and put the sensor back in. If CO2 is and ending ingredient, then the amount of CO2 in the jar should go up when you exhale into the jar. Our hypothesis turned out to be correct, so we knew that CO2 was an ending ingredient.
Now we needed to do an exeriment to learn if O2 only goes in and doesn't come out. We were split into groups to create experiments. My group knew that when you blow into something, air comes out, and that when you pull air out of something, new air rushes in. We decided to read the amount of O2 in the jar, then exhale into the jar like for the CO2 test, only we were expecting the O2 level to go down, and it did. This proved that oxygen comes in but not out in resperation.
What we didn't understand was, what was happening to the oxygen, and where does the CO2 and H2O come from. We started to mention atoms in class. We said that O2 means 2 oxymen atoms together. CO2 means 1 carbon atom, and 2 oxygen atoms. H2O means 2 hydrogen atoms and 1 oxygen atom. So really it wasn't O2 going in and H2O/ CO2 coming out, it was two oxygen atoms going in and 2 oxygen atoms coming out with one carbon atom and 2 hydrogen atoms.
But we still had the same problem, where did the carbon atom and two hydrogen atoms come from. We eventually said from food and water we eat and drink. We looked it up and carbohydrates are made of hydrogen, carbon and oxygen. The formula for carbohydrates is C6 H12 O6. Now the intake was O8 C6 H12 but the exhale was still CO2 and H2O. We needed to find the balanced amount that could go in and come out as complete CO2s and H2Os. We came up with C6 H12 O18 as the formula that creates complete resperation.
Now we are starting to understand photosythesis in class. I think that photosynthesis does everything reverse.
Thursday, November 5, 2009
This week, the whole three days were devoted to the parts of animal, plant, and bacteria cells. We discussed simalarities and differences between the three. We used triple ven diagrams to compare the three cells. The animal and plant cells had almost all of the same organells. Their shapes though were completly different. A plant cell is like a brick and all the cells fit together. Animal cells have a sphere shape.
The three main organell differences between animal and plant cells are the chlorolplasts, cell wall, and vacuole. Chlorolplasts are only in plant cells. They create chlorophil to make the plant green. Only the plant cells has the cell wall and they use it to create their brick shape. The vacuole is in both cells, but it is bigger in the plant cell. The larger vacuole fills with water and makes the cell rigid. That is why when plants don't get water they wilt. This happens because the vacuole is drying up.
The last thing we did was talk about paramecium. We learned they are animal cells and is covered in cilla to move. We decided it lives in stagnant water like a lake or pond. We looked under a microscope at lake water to see what we could find. The paramecium we found were extremly fast and tiny. All that we couls make out was a clear oval with a black outline.
The three main organell differences between animal and plant cells are the chlorolplasts, cell wall, and vacuole. Chlorolplasts are only in plant cells. They create chlorophil to make the plant green. Only the plant cells has the cell wall and they use it to create their brick shape. The vacuole is in both cells, but it is bigger in the plant cell. The larger vacuole fills with water and makes the cell rigid. That is why when plants don't get water they wilt. This happens because the vacuole is drying up.
The last thing we did was talk about paramecium. We learned they are animal cells and is covered in cilla to move. We decided it lives in stagnant water like a lake or pond. We looked under a microscope at lake water to see what we could find. The paramecium we found were extremly fast and tiny. All that we couls make out was a clear oval with a black outline.
Saturday, October 31, 2009
Science October 31st
This week we concluded that salminila caused the outbreak at Jefferson and Truman. Salminila fit in every way. It had the same symptoms. It is Gram negitive like our grams test said. Lastly it is a bacteria common in chicken which we had deduced was where the outbreak was coming from. Our lab reports were supposed to explain the prosseses we went through to reach our final decicion.
Now we wanted to know, what is a cell? What are they made of, what do they do, what do they look like? We conducted a test to look at our cheek cells. One slide was made with water and cells, another was made with cells and methaline blue. The methaline blue made the cells more visable under microscope. We saw all of the cells have a dot in the center called a nucleus. We could also just make out other things in the cell. The cells, even for tiny things are very complex. This was proven through homework where we had to draw a labled diagram of animal and plant cells. They are different, but relativly the same. Some things like the vacuole are only in the plant cell and visa versa.
What do plant cells look like under a microscope? We cut a potato into see through slices, then we could see the cells within under a microscope. We used two dies this time. Lugal solution and Methaline blue. Each showed different parts of the cells better. I believe the metaline blue shows the nucleus and lugal shows the other organelles. We also looked at grass which was amazing to look at. Each cell was like a brick and they all fit together in perfect rows. It was like a wall. I couldn't see the different parts of the cell like in the potatos. I think that is because the grass has color and is not clear like the potato cells.
On Friday we played a game to test our knowlage of plant and animal cells. We took a long time with the plant cell and went very quickly on the animal cell. Many of the parts with simaler names and places got very mixed up. The whole week turned out to be a test devised by Mr. Finley to learn if something he learned at a teachers meeting was true, and it was.
Now we wanted to know, what is a cell? What are they made of, what do they do, what do they look like? We conducted a test to look at our cheek cells. One slide was made with water and cells, another was made with cells and methaline blue. The methaline blue made the cells more visable under microscope. We saw all of the cells have a dot in the center called a nucleus. We could also just make out other things in the cell. The cells, even for tiny things are very complex. This was proven through homework where we had to draw a labled diagram of animal and plant cells. They are different, but relativly the same. Some things like the vacuole are only in the plant cell and visa versa.
What do plant cells look like under a microscope? We cut a potato into see through slices, then we could see the cells within under a microscope. We used two dies this time. Lugal solution and Methaline blue. Each showed different parts of the cells better. I believe the metaline blue shows the nucleus and lugal shows the other organelles. We also looked at grass which was amazing to look at. Each cell was like a brick and they all fit together in perfect rows. It was like a wall. I couldn't see the different parts of the cell like in the potatos. I think that is because the grass has color and is not clear like the potato cells.
On Friday we played a game to test our knowlage of plant and animal cells. We took a long time with the plant cell and went very quickly on the animal cell. Many of the parts with simaler names and places got very mixed up. The whole week turned out to be a test devised by Mr. Finley to learn if something he learned at a teachers meeting was true, and it was.
Saturday, October 24, 2009
10/19 Science
I was only in school for one day this week. In that day we discussed the things in the pond. I shared that the small crustations everyone saw were water fleas. There was also alge in the water that we could see. Nothing we could see was visable. Almost all bacterias and viruses are not visible under a microscope. We said there could still be bacteria in the water.
Next we came up with four possible bacteria for the chicken. Salmonella, staphylococcus aureus, campylobacter, and listeria monocytogenes are all found with chicken.
-Staphylococcus causes pimmples, boils, and impatego. It also causes more life threatening viruses like meningitis and pneumonia. None of these diseases relate to the symptoms the infected people described.
-Salmonella is found in eggs. It is one of the most common foodborn diseases. People expirience fever, diarrhea, abdomanal cramps, chills, nausea, and vomiting. Salmonella has all of the symptoms the middle schoolers had. This is the website I found to learn about salmonella. http://www.fsis.usda.gov/factsheets/salmonella_questions_&_answers/index.asp
-Campylobacter is one of the main cause of bacterial foodborn diseases. It causes tissue damage in the colon. None of the people absent had colon damage.
-Listeria Monocytogenes causes muscle aches, fever, and sometimes nausea and diarrhea. It can cause Menintgitis. It doesn't match at all. The disease only appears in newborns, old people, and pregnant women.
Salmonella is the one the fits the discription most. The chicken could have had a lot on it and the kids ate it.
Next we came up with four possible bacteria for the chicken. Salmonella, staphylococcus aureus, campylobacter, and listeria monocytogenes are all found with chicken.
-Staphylococcus causes pimmples, boils, and impatego. It also causes more life threatening viruses like meningitis and pneumonia. None of these diseases relate to the symptoms the infected people described.
-Salmonella is found in eggs. It is one of the most common foodborn diseases. People expirience fever, diarrhea, abdomanal cramps, chills, nausea, and vomiting. Salmonella has all of the symptoms the middle schoolers had. This is the website I found to learn about salmonella. http://www.fsis.usda.gov/factsheets/salmonella_questions_&_answers/index.asp
-Campylobacter is one of the main cause of bacterial foodborn diseases. It causes tissue damage in the colon. None of the people absent had colon damage.
-Listeria Monocytogenes causes muscle aches, fever, and sometimes nausea and diarrhea. It can cause Menintgitis. It doesn't match at all. The disease only appears in newborns, old people, and pregnant women.
Salmonella is the one the fits the discription most. The chicken could have had a lot on it and the kids ate it.
Sunday, October 18, 2009
Science October 18
This week we finally tested for organisms in the pond water, in the chicken, on the knife, on the pan, and in or on the bread samples.We had to have one microsope test and test at least two things in a petri dish. Before we were allowed to use the microscopes we had to take three quizes.
Monday: I was not there on Monday because of a doctors appointment. When I got to class in the last five minutes the rest of my group was doing a reviw sheet. We did not get much done.
Tuesday: On tuesday we made our petri dish and took the written parts quiz. We first divided the petri dish into fourths and labled them. One was chicken surface and another was top of bread. The other two were knife handle and pond water. The parts quiz was difficult, it took a while but I remembered all but one part, the Body Tube. The day helped me learn to write my procedures as specific as posible.
Wednesday: We observed our petri dish from yesterday. My prediction was that the chicken and knife would have the same amount and that the pond water would have the most bacteria also. I was wrong on both acounts. The chicken ended up having it's whole quarter filled with yellow bactiria. The water had a lot, just not as much. The knife had only 10 small colonies and the bread had none. After everything was recorded, we took the oaral parts and functions quiz.
Thursday: We observed our petri dish one more time. The chicken looked the same, maybe a little bigger. The pond water had more colonies than the day before and they were bigger. The colonies on the knife had gotten bigger. Three that had been close the day before has fused because they grew. The top to the bread still had no bacteria. Then we took the slide making quiz. After that we were free to use the microscopes. We wrote down our procedures, got them approved and spent ten minutes on a microscope looking at pond water. We did not make any pictures on thursday which was a mistake.
Friday: We spent the whole class looking at the pond water through a microscope. We found a very fast organism that looked like a shrimp. It had two eyes, a tail to move with, feelers coming from a mouth of some sort, and multiple legs from its abdomen. It did not look like its eyes were very good because it kept hitting plant life. I looked it up and it is a form of crustation. It is a water flea. The type of water flea I, was unable to determine.
Now my group just needs to get the blood results and make our lab reports.
Monday: I was not there on Monday because of a doctors appointment. When I got to class in the last five minutes the rest of my group was doing a reviw sheet. We did not get much done.
Tuesday: On tuesday we made our petri dish and took the written parts quiz. We first divided the petri dish into fourths and labled them. One was chicken surface and another was top of bread. The other two were knife handle and pond water. The parts quiz was difficult, it took a while but I remembered all but one part, the Body Tube. The day helped me learn to write my procedures as specific as posible.
Wednesday: We observed our petri dish from yesterday. My prediction was that the chicken and knife would have the same amount and that the pond water would have the most bacteria also. I was wrong on both acounts. The chicken ended up having it's whole quarter filled with yellow bactiria. The water had a lot, just not as much. The knife had only 10 small colonies and the bread had none. After everything was recorded, we took the oaral parts and functions quiz.
Thursday: We observed our petri dish one more time. The chicken looked the same, maybe a little bigger. The pond water had more colonies than the day before and they were bigger. The colonies on the knife had gotten bigger. Three that had been close the day before has fused because they grew. The top to the bread still had no bacteria. Then we took the slide making quiz. After that we were free to use the microscopes. We wrote down our procedures, got them approved and spent ten minutes on a microscope looking at pond water. We did not make any pictures on thursday which was a mistake.
Friday: We spent the whole class looking at the pond water through a microscope. We found a very fast organism that looked like a shrimp. It had two eyes, a tail to move with, feelers coming from a mouth of some sort, and multiple legs from its abdomen. It did not look like its eyes were very good because it kept hitting plant life. I looked it up and it is a form of crustation. It is a water flea. The type of water flea I, was unable to determine.
Now my group just needs to get the blood results and make our lab reports.
Subscribe to:
Posts (Atom)
