It was a bad week in science this week. We had a sub twice in the week and I was absent one of the days the sub was there. We continued with mitosis this week. We talked about how chromosomes change during mitosis and a cell's life. They start as chromatin, and unwoung mess of DNA in the nucleus. Then it condences into a chromosome. Then the chromosome is copied and conected to the copy at a kinetacore. The two chromosomes individualy are now called chromatids, while together they are a chromosome. Then when the two chromatids separate during anaphase of Mitosis, they are each chromosomes again. And in telophase when two nuclei are formed they unwind into chromatin again.

We then learned about the cell cycle. It has four stages. Gap 1, Syntesis, Gap 2, and Mitosis. In Gap 1 the cell does regular things like making protiens and growing. At the end of Gap 1, the cell checks if all the conditions are right to reproduce. If not, it repeats Gap 1, if the conditions are right it moves to synthesis. In synthesis the cell copies all the DNA in it's nucleus. Then it moves to Gap 2 where it grows more in preporation to Mitosis, and it makes any protiens it will need in Mitosis. Now the cell moves to Mitosis where it splits apart to form two daughter cells. Then the cell cycle starts over with Gap 1 in both cells. The lenth of the full cycle varies for different types of cells. A skin cell might take 8 hours to go through the cycle, but a heart cell could take 45 years.

We learned about how much time a cell spends in each phase, Interphase, Prophase, Metaphase, Anaphase, and Telophase. 56% of it's time is in Interphase, 28% in Prophase, 8% in Metaphase, 6% in Anaphase, and 3% in Telophase. So if it takes a cell 24 hours to go through all these, 13.44 hours are spent in Interphase, 6.72 hours in Prophase, 1.92 hours in Metaphase, 1.44 hours in Anaphase, and 0.72 hours in Telophase.

Science First week after Christmas 1/9

This week was kind of awkward because we were discossing reproduction and its difference from sex. The first thing we wanted to do was clarrify the difference between the two things. We only want to learn about reproduction. Reproduction is the sperm meeting with the egg cell. We knew how mammals and some other animals reproduced, but we did not know how cell reproduce. A living thing grows because cells are reproducing. Cells reproducing is the basic part of human reproduction.

We had two theories on how cells reproduce.One theory we had was that cells reproduced with a sperm cell and egg cell. But this didn't make sence because a single cell would not produce a sperm cell and an egg cell just to make one cell. Also, we knew cells reprodused as one not as two, unlike humans. Our other theory was that cells split themselves in half from one mother cells into two daughter cells.

Wecame up with certain things that must happen in cell reproduction.DNA must be copied because otherwise the cells would not look the same and they would each only have half the DNA the original cell had. Another problem was having each cell have all of the organelles such as mitochondria and ribosomes. We thought that that the cell may create double the amount of each organelle it has. The last problem we saw was if a cell splits in half, it makes two cells half the size the origonal. This would cause the organism not to grow. We decided that the cells must grow at some point in their life.

We learned that the Cell does copy its DNA and reproduce in a prosses called mitosis. The steps of mitosis are Prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis. In prophase DNA is copied and the nucleus begins to fade. In Prometaphase the nucleus is gone and there is only chromosomes. Metaphase is when the chromosomes align in the center of the cell. Anaphase is when spindle fibers connect to the kinetochores and start to pull the chromosomes apart from their copies to the poles of the cell. In telophase the chromosomes form two nuclei at the poles of the cell. In the last step cyokinesis, the cell separates into two separate cells.

Science Before Christmas

This week was all about cells. We read about the discovery of DNA and about resperation vs photosynthosis. We watched a great video about a Ribosome and RNA. It showed how all the organelles work together. All of the organelles seem to need the ribosome or help the ribosome. It also showed how much is cramed in a tiny little cell.

Another video we watched was Yakko's Universe Song. The song tells how everything is made of something smaller. We did this on humans. Atoms makes molucules, and molucules make organelles, organelles make cells, to tissue, tissues make organs, and organs make systems, and all of the systems make a human being. The video helped me understand how small things get. Where if you can't see a cell with a naked eye, then how small is the stuff smaller than a cell.

We have been given the project of thinking of something in life like a city of country that is like a cell. I choose a town because everything inside works together to do things. Also, there are a lot of things that can be compared to cell organelles. A city hall is like the nucleus. Taxes are like the mRNA. Money is like the protiens. A tax office is like a rough E.R and ribosomes are houses and stores. A train station could be like the golgi apperatus. A power plant is like the mitocondria doing resperation. All of these things work together like the organelles of a cell.

December 12th

We talked about the parts of DNA. It has two sugar backbones conected by four kinds of bases. Adenine, thynine, cytozine, and guadenine (Abriviated: A, T, C, G). A and T are a base pair and connect together. G and C are a base pair, so they connect together. If you had a sugar backbone with AACGCTGGCTTTAGCCTAAA, the other sugar backbone would be, TTGCGACCGAAATCGGATTT.

All week we talked about DNA and RNA. We learned what transcription and protein syntheis are. Transcription is the prosses that creates mRNA. Protein syntheis is the prosses that creates proteins using mRNA. Transcription is done by unraveling a part of a DNA strand. Then, extra bases start to match with their pairs in the DNA. these bases form RNA. when the copy is complete, the RNA strand leaves the nucleus and the DNA ravels back up.

The video we watched was protein synthesis, the brain tells the cell to make a certian protein. Then, the DNA is unraveled and the instructions on making the protein are copied in mRNA. The RNA is then sent to bind with a ribosome to be decoded. The RNA is decoded in codons (sets of three bases) that stand for different amino acids. Then tRNA with the opposite bases to the codon gets the amino acid and brings it to the ribosome. Each amino acid is put together in the same order as on the mRNA. Once all of the amino acids are put together, the mRNA breaks apart, so the bases can be reused. All of the amino acids together make the protein.

The bases in DNA and RNA are like magnets. Opposites attract like the positive and negative poles of a magenant. This concept helps in making DNA, making RNA, and getting amino acids.
Adenine and Thynine are opposites, and Guadenine and Cytozine are like the poles. You can't find two adenines together.

Science December 1st-5th

This week we continued with photosynthosis in class. We noticed that resperation and photosynthosis work as a cycle in some ways. The starting material for each is the ending for the other. They help each other to complete their job. They are also not a cycle because new CO2 and H2O are always coming in and O2 is always leaving. We also learned that photosynthosis is like the opposite of resperation.

Thenwe talked about what happens when you have resperation without O2. It turns out that cramps are caused when there is resperation without O2. Also, when you don't have oxygen, instead of H2O being an end result, in animals lacticacid takes its place. In plants alcohol takes H2O's place. To test if resperation really could happen without O2 we put yeast, water, and sugar in a large test tube. We put a ballon at the end of the vial. If the ballon folls with air we thought, then resperation occured. An d the ballon did inflate.

We talked about DNA too. Deoxyribonucleic acid (DNA) we said is found in the nucleus or nucleoid of cells. It controls what the cell does, and how it looks. Every person, besides twins, have different DNA because each person's DNA is a combo of both of their parent's DNA. Anything born from only one parent looks exactly like that parent because there is no combo of DNA.

We wanted to see what DNA looked like. We mixed water in our mouths for 1 minute then spit it in a cup. Next we mixed with detergent, contact solution and rubbing alcohol in a vial. In fifteen minutes the result was white stringy subbstances forming in the water. The mixture had broken through the cell membrane in our cheek cells. This let the DNA out which formed the white strings. As extra credit I am going to do the same experiment with plant cells. Then we are going to look at the DNA under microscopes.

This week we talked about resperation and photosythosis. We wanted to know what resperation does and what ingredients it uses. We broke it down into an intake and exhale. Someone said that O2 (oxygen) goes is, and CO2 (carbondioxide) comes out. Also, we knew for a fact from a past experiment that H2O is exhaled in resperation. We did experiments and reaserch to learn if this was true and if there was anything else to reperation.

Our first test was to see if it was true that CO2 is expeled in resperation. Mr. Segan had a CO2 sensor that we could use. The experiment was, we put the CO2 sensor in a jar and got a control reading. Then we took out the sensor and Mr. Segan exhaled into the jar and put the sensor back in. If CO2 is and ending ingredient, then the amount of CO2 in the jar should go up when you exhale into the jar. Our hypothesis turned out to be correct, so we knew that CO2 was an ending ingredient.

Now we needed to do an exeriment to learn if O2 only goes in and doesn't come out. We were split into groups to create experiments. My group knew that when you blow into something, air comes out, and that when you pull air out of something, new air rushes in. We decided to read the amount of O2 in the jar, then exhale into the jar like for the CO2 test, only we were expecting the O2 level to go down, and it did. This proved that oxygen comes in but not out in resperation.

What we didn't understand was, what was happening to the oxygen, and where does the CO2 and H2O come from. We started to mention atoms in class. We said that O2 means 2 oxymen atoms together. CO2 means 1 carbon atom, and 2 oxygen atoms. H2O means 2 hydrogen atoms and 1 oxygen atom. So really it wasn't O2 going in and H2O/ CO2 coming out, it was two oxygen atoms going in and 2 oxygen atoms coming out with one carbon atom and 2 hydrogen atoms.

But we still had the same problem, where did the carbon atom and two hydrogen atoms come from. We eventually said from food and water we eat and drink. We looked it up and carbohydrates are made of hydrogen, carbon and oxygen. The formula for carbohydrates is C6 H12 O6. Now the intake was O8 C6 H12 but the exhale was still CO2 and H2O. We needed to find the balanced amount that could go in and come out as complete CO2s and H2Os. We came up with C6 H12 O18 as the formula that creates complete resperation.

Now we are starting to understand photosythesis in class. I think that photosynthesis does everything reverse.

This week, the whole three days were devoted to the parts of animal, plant, and bacteria cells. We discussed simalarities and differences between the three. We used triple ven diagrams to compare the three cells. The animal and plant cells had almost all of the same organells. Their shapes though were completly different. A plant cell is like a brick and all the cells fit together. Animal cells have a sphere shape.



The three main organell differences between animal and plant cells are the chlorolplasts, cell wall, and vacuole. Chlorolplasts are only in plant cells. They create chlorophil to make the plant green. Only the plant cells has the cell wall and they use it to create their brick shape. The vacuole is in both cells, but it is bigger in the plant cell. The larger vacuole fills with water and makes the cell rigid. That is why when plants don't get water they wilt. This happens because the vacuole is drying up.



The last thing we did was talk about paramecium. We learned they are animal cells and is covered in cilla to move. We decided it lives in stagnant water like a lake or pond. We looked under a microscope at lake water to see what we could find. The paramecium we found were extremly fast and tiny. All that we couls make out was a clear oval with a black outline.